si:ch211-51a6.2

Ensembl ID:
ENSDARG00000030967
ZFIN ID:
ZDB-GENE-090313-118
Description:
Novel protein similar to vertebrate protease, serine, 12 (Neurotrypsin, motopsin) (PRSS12) [Source:U
Human Orthologue:
PRSS12
Human Description:
protease, serine, 12 (neurotrypsin, motopsin) [Source:HGNC Symbol;Acc:9477]
Mouse Orthologue:
Prss12
Mouse Description:
protease, serine, 12 neurotrypsin (motopsin) Gene [Source:MGI Symbol;Acc:MGI:1100881]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5858 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42181 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021556 Essential Splice Site 118 832 3 14
ENSDART00000140307   None 554 None 8
Genomic Location (Zv9):
Chromosome 13 (position 21932350)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21661688
KASP Assay ID:
554-3952.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAGAAGTCTGGAGCCRTCGGGTGGGCTTACTGTGACTGCCACCAGGG[T/C]GAGCTCTACTCAATGCCTTCTCTCATGCAGTCATATTTATGGTGGTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021556 Nonsense 257 832 6 14
ENSDART00000140307   None 554 None 8
Genomic Location (Zv9):
Chromosome 13 (position 21941418)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21670756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTGTGGAGGTGTATTATAATGGACGGTGGGGGACCATCTGTGATGAC[G/T]AGTGGGATGATATTGATGCTGAAGTGGTTTGCAGACAGTTGGGATTGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link