si:ch211-89p1.4

Ensembl ID:
ENSDARG00000030961
ZFIN IDs:
ZDB-GENE-030131-1821, ZDB-GENE-050522-275
Description:
Putative adenylate kinase-like protein C9orf98 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q502L7]
Human Orthologue:
C9orf98
Human Description:
chromosome 9 open reading frame 98 [Source:HGNC Symbol;Acc:26526]
Mouse Orthologue:
1190002A17Rik
Mouse Description:
RIKEN cDNA 1190002A17 gene Gene [Source:MGI Symbol;Acc:MGI:1916120]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15325 Essential Splice Site Available for shipment Available now
sa10279 Nonsense Available for shipment Available now
sa31449 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043096 Essential Splice Site 56 486 3 14
Genomic Location (Zv9):
Chromosome 5 (position 31311219)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29072576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCCCATTCAATACYTGAYTAAYTTTCTGGAAAGGGACAATGTYGATG[G/A]TAAGATTTRTGTAATTGTGCCTGAATCCTTAGAAATGWTTATTATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043096 Nonsense 423 486 14 14
Genomic Location (Zv9):
Chromosome 5 (position 31349225)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29110582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAACCTCCTCCTGGTCCGGAAGTTCARGCACGGCTTCGGTTTAACCCA[C/T]AGCATTCAGAGGCACAGCTGTTAATGAGGCTTAAGGAATACTGGAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043096 Nonsense 437 486 14 14
Genomic Location (Zv9):
Chromosome 5 (position 31349269)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29110626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCACAGCATTCAGAGGCACAGCTGTTAATGAGGCTTAAGGAATACTG[G/A]AGCCAAACAGTGCGCCTGCAGGCCTTCTACCCACAGGCAGTGTACATCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link