ftr56

Ensembl ID:
ENSDARG00000030954
ZFIN ID:
ZDB-GENE-030131-2801
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXS0]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8856 Nonsense Mutation detected in F1 DNA During 2014
sa23480 Nonsense Mutation detected in F1 DNA During 2014
sa4069 Nonsense Mutation detected in F1 DNA During 2014
sa8740 Nonsense Mutation detected in F1 DNA During 2014
sa9701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 77 561 1 6
Genomic Location:
Chromosome 19 (position 13026402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAAGACCTGCTTTAAATAAAAACACCATGCTGGCTGAAGTGGTGRAG[C/T]AACTGAAGAAGWCWRAACATCACACTSCTGCTGTTCCTGCTGGAGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 125 561 1 6
Genomic Location:
Chromosome 19 (position 13026258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGTCCTGTCTGGTGTGTCTGAACTCTTACTGTCAAAATCATCTTGAA[C/T]AACATGAGAATCTCTTCAAAGGTAAAAGACACAACCTAATAGACGCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 421 561 6 6
Genomic Location:
Chromosome 19 (position 13021581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATCCTGATCATTTAGACAGATTTGATCAGTGTCGTCAGGTGCTGTGC[A/T]GAGAGAGTGTTTGTGGACGCTGCTACTGGGAGGTGGAGTGGAGTGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 444 561 6 6
Genomic Location:
Chromosome 19 (position 13021510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTACTGGGAGGTGGAGTGGAGTGGGAATGNNNTAGATATTTCAGTGTCATA[T/G]WAAAGCATCARCAGAAAGGGAGAGGSTGACGTTCAGTGTAGATTTRGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103703 Nonsense 445 561 6 6
Genomic Location:
Chromosome 19 (position 13021509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTACTGGGAGGTGGAGTGGAGTGGGAATGNNNTAGATATTTCAGTGTCATAK[A/T]AAAGCATCARCAGAAAGGGAGAGGSTGACGTTCAGTGTAGATTTRGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n714k3uo