NR_023325.1

Ensembl ID:
ENSDARG00000030945
Description:
wu:fj53g11 (wu:fj53g11), non-coding RNA [Source:RefSeq DNA;Acc:NR_023325]
Human Orthologue:
KIAA0100
Human Description:
KIAA0100 [Source:HGNC Symbol;Acc:28960]
Mouse Orthologue:
2610507B11Rik
Mouse Description:
RIKEN cDNA 2610507B11 gene Gene [Source:MGI Symbol;Acc:MGI:1919753]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14495 Nonsense Available for shipment Available now
sa17554 Essential Splice Site Available for shipment Available now
sa10040 Nonsense Available for shipment Available now
sa16334 Nonsense Available for shipment Available now
sa16877 Nonsense Available for shipment Available now
sa16463 Nonsense Available for shipment Available now
sa1105 Nonsense F2 line generated During 2017
sa24979 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 98 2218 4 39
Genomic Location (Zv9):
Chromosome 15 (position 15192367)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16237330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGAGGTTTTTGGCGCTGTGTGTTGGTGAGGCCCGGGTCCGCTTCGACT[T/A]GCAGGAACCCTTTAGGCCCCGGGTCCCAAACAAAAAWGAGGAGAATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Essential Splice Site 337 2218 9 39
Genomic Location (Zv9):
Chromosome 15 (position 15186336)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16231299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCTGAGCTCAGTTTCCCACAGAGCCGCCTGGAGCTTCTGCTGGAGGG[T/C]GAGTTTGAAAACACACTCTTTATCACTGTTATTATTGCWCTGGACGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 975 2218 16 39
Genomic Location (Zv9):
Chromosome 15 (position 15171427)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16216390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGCACTTGCAGATCAGTCTTTGCATGGCCCAGAGCAGATCCGAGAG[C/T]AGCTGCGGGACATCGATGGTGTCAGCCCCTTCCCCAGAGATGGCCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 1357 2218 23 39
Genomic Location (Zv9):
Chromosome 15 (position 15163157)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16208120
KASP Assay ID:
2260-8252.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTMTGCTGAAATGATGGATGCCTGTTTTCTAGCTGGCACTGTGATGAGA[C/T]GACTGATCTCTGAGTGGAACGTCACTCAGATGGTGAGCGATCTCTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 1569 2218 25 39
Genomic Location (Zv9):
Chromosome 15 (position 15160950)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16205913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGATGATGTTTACAACCGCAACTGGTTCATAGAGCTCGTCAATGGA[C/T]AGGTAAGTATTAAAGGTGCCAYARAATGAACATTTAGGTACAGCTATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 1647 2218 27 39
Genomic Location (Zv9):
Chromosome 15 (position 15158040)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16203003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATMCCATTTTGTGAACCTGCAGGTGAAGAACATTGAGGAAYACAGA[C/T]AGAGGAATCTGGACTCAGTGCTGGAGCTGATGGAGAGCGGTCAGGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1105
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Nonsense 2033 2218 35 39
Genomic Location (Zv9):
Chromosome 15 (position 15148986)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16193949
KASP Assay ID:
554-1007.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAGAAATGTGGAAGAGGAAGAAGTTGGGGATGAGGAGGACAAGTTC[A/T]GATTGGTTACTACAGGTTTGTCAACATGGTTACTTTTTTTTTTTTCNNGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091772 Essential Splice Site 2157 2218 38 39
Genomic Location (Zv9):
Chromosome 15 (position 15144783)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16189746
KASP Assay ID:
554-7866.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCGCTATGGCTGTGAAAAGAGACAGTCGGAAAGCGCTAGTTGCACAG[G/A]TAATCACTAGACAGAAAATCAACCTTTAAAGGTGCTCGATGTACAATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link