NP_878290.1

Ensembl ID:
ENSDARG00000030932
Description:
fibroblast growth factor 10 [Source:RefSeq peptide;Acc:NP_878290]
Human Orthologue:
FGF10
Human Description:
fibroblast growth factor 10 [Source:HGNC Symbol;Acc:3666]
Mouse Orthologue:
Fgf10
Mouse Description:
fibroblast growth factor 10 Gene [Source:MGI Symbol;Acc:MGI:1099809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048581 Nonsense 106 201 2 3
Genomic Location (Zv9):
Chromosome 21 (position 18507557)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19643046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGACGTTGTTTTGATGATATGTTTACGTTTGTTTTGTAGGTACACTC[G/T]AAATCAAGTCTGTGGATGTGGGCATCGTTGCCATCAAGGGGATTCAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link