foxq1l

Ensembl ID:
ENSDARG00000030896
ZFIN ID:
ZDB-GENE-070424-74
Description:
Zgc:162905 protein [Source:UniProtKB/TrEMBL;Acc:Q566W3]
Human Orthologue:
FOXQ1
Human Description:
forkhead box Q1 [Source:HGNC Symbol;Acc:20951]
Mouse Orthologue:
Foxq1
Mouse Description:
forkhead box Q1 Gene [Source:MGI Symbol;Acc:MGI:1298228]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8070 Nonsense Mutation detected in F1 DNA During 2014
sa9415 Nonsense Available for shipment Available now
sa18716 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 227 310 1 1
Genomic Location:
Chromosome 2 (position 902819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCGAGCGGAAAGTTCACCAGTTCTTTCGCCATTGAGAGCATCCTCAGT[C/T]RACCCTTCAGAAGGGAGGACCGCCCCGTGCTCAGCCCTGACACCTGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 270 310 1 1
ENSDART00000045770 Nonsense 270 310 1 1
Genomic Location:
Chromosome 2 (position 902690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCTTCGATCCTATGGTGCCCTRGAGGACCCTTCCRTGAGCCGCCGA[C/T]AGCGCGACTTTTTCGCATTCCAGCTGCCRCCTGAGTGCCTCTCAATCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045770 Nonsense 270 310 1 1
ENSDART00000045770 Nonsense 270 310 1 1
Genomic Location:
Chromosome 2 (position 902690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCTTCGATCCTATGGTGCCCTGGAGGACCCTTCCATGAGCCGCCGA[C/T]AGCGCGACTTTTTCGCATTCCAGCTGCCGCCTGAGTGCCTCTCAATCCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)
  • Pancreatic cancer: Genome-wide association study of pancreatic cancer in Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vdatm560