cetp

Ensembl ID:
ENSDARG00000030872
ZFIN ID:
ZDB-GENE-041114-54
Description:
cholesteryl ester transfer protein [Source:RefSeq peptide;Acc:NP_001007361]
Human Orthologue:
CETP
Human Description:
cholesteryl ester transfer protein, plasma [Source:HGNC Symbol;Acc:1869]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23273 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046891 Nonsense 128 493 4 16
Genomic Location:
Chromosome 18 (position 17274545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTCATAACAGTATGACTGTTGTGTTCTTCCTCACACAGGCTCAGCT[T/G]AAACCAGTCAATGGATTTTGAAGTTGAGTCTCAAATTGACCTGGTCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/topza0er