klf11a

Ensembl ID:
ENSDARG00000030844
ZFIN ID:
ZDB-GENE-030131-3568
Description:
Kruppel-like factor 11a [Source:RefSeq peptide;Acc:NP_001038406]
Human Orthologue:
KLF11
Human Description:
Kruppel-like factor 11 [Source:HGNC Symbol;Acc:11811]
Mouse Orthologue:
Klf11
Mouse Description:
Kruppel-like factor 11 Gene [Source:MGI Symbol;Acc:MGI:2653368]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043459 Nonsense 107 459 3 4
ENSDART00000148278 Nonsense 127 479 3 4
Genomic Location:
Chromosome 20 (position 29529553)
KASP Assay ID:
554-0892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTACCTCAGTGGCCTGCTCAGGTCTAAAACCACATCCCAGACTATG[T/A]TCAGCCTTGACCAACAGAGCTGCATGTCATGTCAGCTTGCATCCCAGTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0onqjmxt