otof

Ensembl ID:
ENSDARG00000030832
ZFIN ID:
ZDB-GENE-030131-7778
Description:
Otoferlin [Source:UniProtKB/Swiss-Prot;Acc:Q5SPC5]
Human Orthologue:
OTOF
Human Description:
otoferlin [Source:HGNC Symbol;Acc:8515]
Mouse Orthologue:
Otof
Mouse Description:
otoferlin Gene [Source:MGI Symbol;Acc:MGI:1891247]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4097 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17391 Nonsense Available for shipment Available now
sa23735 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23736 Nonsense Mutation detected in F1 DNA During 2014
sa18571 Nonsense Available for shipment Available now
sa4912 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 None None 1837 None 43
ENSDART00000136255 Essential Splice Site 27 1992 1 46
Genomic Location:
Chromosome 20 (position 31102526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGAGCTCCGTGGGAAGGGGGACCGAATCGCTAAAGTCACTTTCAGAGG[T/G]AAAGAGCGATACNTTTTTTCATTTACAGTGAACGGGTGTGTGCTCGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 38 1837 2 43
ENSDART00000136255 Nonsense 212 1992 7 46
Genomic Location:
Chromosome 20 (position 31189503)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTTGTGTGCAGATGATGCKGCYATTCTGGATGCAGAAGATCTGGAT[C/T]GAAAAGCCATGCGTCTAGGCGGCATTCTTGACCCTGATACAATCTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Essential Splice Site 151 1837 5 43
ENSDART00000136255 Essential Splice Site 325 1992 10 46
Genomic Location:
Chromosome 20 (position 31195750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCACGTGCCTCCAGACGTCATGTTTGACAAAATTATAAAGATTTCAG[T/C]GAGTAGATAAAGCCACGCATCATACACTTTTACAAACCTTTAATCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 589 1837 14 43
ENSDART00000136255 Nonsense 763 1992 19 46
Genomic Location:
Chromosome 20 (position 31206597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGGTCTGAATGATGTTCAAGAGATCATAAAAACAGAGAAGGCATA[T/A]CCAGAACGAAGACTAAGAGGTGTATTAGAAGAACTTAGCACAAGCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 592 1837 14 43
ENSDART00000136255 Nonsense 766 1992 19 46
Genomic Location:
Chromosome 20 (position 31206604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGAATGATGTTCAAGAGATCAYAAAAACAGAGAAGGCATATCCAGAA[C/T]GAAGACTWAGAGGTGTATTAGAAGAACTTAGCACAAGCTGCAGGTGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008840 Nonsense 1733 1837 41 43
ENSDART00000136255 Nonsense 1890 1992 44 46
Genomic Location:
Chromosome 20 (position 31232404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCATCTTCAAACAAAAGAGAGTCAAGGGCTGGTGGCCATTTGTGGCC[C/T]AAAATGAGAATGATRAATTTGAGCTAACGGTGAGTTTATRGAATGTYGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mucp79hu