ftsjd2

Ensembl ID:
ENSDARG00000030830
ZFIN ID:
ZDB-GENE-040426-696
Description:
Cap-specific mRNA (nucleoside-2'-O-)-methyltransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q803R5]
Human Orthologue:
FTSJD2
Human Description:
FtsJ methyltransferase domain containing 2 [Source:HGNC Symbol;Acc:21077]
Mouse Orthologue:
Ftsjd2
Mouse Description:
FtsJ methyltransferase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1921407]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24383 Essential Splice Site Available for shipment Available now
sa44029 Nonsense Mutation detected in F1 DNA During 2016
sa32458 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049373 Essential Splice Site 390 829 11 24
ENSDART00000142038   None 192 None 6

The following transcripts of ENSDARG00000030830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 35434447)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35284039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTGCTCCTGTGTCAATTTCTTACCGCCCTGTCTGTCGTCAGACCAGG[T/C]GATGTGTGTGTGCTTTTGTTTTTGTGTGTACGTATATTTATATATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049373 Nonsense 450 829 13 24
ENSDART00000142038   None 192 None 6

The following transcripts of ENSDARG00000030830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 35425940)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35275532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTACGTGGTGTGCAAGGGTTTAAAACCAGGCACGGATGCCGTCAGA[G/T]AATACATGTTCACCATCAACCTGAAGCTGAATCAGTTCAGACACTCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049373 Nonsense 827 829 24 24
ENSDART00000142038   None 192 None 6

The following transcripts of ENSDARG00000030830 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 35414787)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35264379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACAAGCTCTCCAAAGATGATGTGGTTTCCTTCATCCATAAGCACTA[T/A]CAACAATAACCACACACATGCACACACAAAGTAACAGACTGTTCATTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link