ftsjd2

Ensembl ID:
ENSDARG00000030830
ZFIN ID:
ZDB-GENE-040426-696
Description:
Cap-specific mRNA (nucleoside-2'-O-)-methyltransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q803R5]
Human Orthologue:
FTSJD2
Human Description:
FtsJ methyltransferase domain containing 2 [Source:HGNC Symbol;Acc:21077]
Mouse Orthologue:
Ftsjd2
Mouse Description:
FtsJ methyltransferase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1921407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24383 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049373 Essential Splice Site 390 829 11 24
ENSDART00000142038 None None 192 None 6

The following transcripts of ENSDARG00000030830 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 35434447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTGCTCCTGTGTCAATTTCTTACCGCCCTGTCTGTCGTCAGACCAGG[T/C]GATGTGTGTGTGCTTTTGTTTTTGTGTGTACGTATATTTATATATATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qrfs8t0v