esyt2a

Ensembl ID:
ENSDARG00000030824
ZFIN ID:
ZDB-GENE-070912-588
Human Orthologue:
ESYT2
Human Description:
extended synaptotagmin-like protein 2 [Source:HGNC Symbol;Acc:22211]
Mouse Orthologue:
Esyt2
Mouse Description:
extended synaptotagmin-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:1261845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19841 Essential Splice Site Available for shipment Available now
sa32999 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009093 Essential Splice Site 384 888 9 23
ENSDART00000139929 Essential Splice Site 384 867 9 22
ENSDART00000146803   None 166 None 5
Genomic Location (Zv9):
Chromosome 2 (position 42557574)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42607038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAATCATCAAAGATTCCTTAAACCCTAGGTGGAATGAAGTATACGAG[G/A]TGGGTTTTTAGCGTCTAAGTGTCTTTCTGAAATAATTTTTTGAACTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009093 Essential Splice Site 385 888 10 23
ENSDART00000139929 Essential Splice Site 385 867 10 22
ENSDART00000146803   None 166 None 5
Genomic Location (Zv9):
Chromosome 2 (position 42557501)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42606965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTGAAATAATTTTTTGAACTAACTGAGTTGTTTATGTGTGTGTTAT[A/G]GGCGATTGTGTATGATGGTCAAGGACAGGTTGTGTTCATAGAGCTGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link