esyt2a

Ensembl ID:
ENSDARG00000030824
ZFIN ID:
ZDB-GENE-070912-588
Human Orthologue:
ESYT2
Human Description:
extended synaptotagmin-like protein 2 [Source:HGNC Symbol;Acc:22211]
Mouse Orthologue:
Esyt2
Mouse Description:
extended synaptotagmin-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:1261845]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19841 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009093 Essential Splice Site 384 888 9 23
ENSDART00000139929 Essential Splice Site 384 867 9 22
ENSDART00000146803 None None 166 None 5
Genomic Location:
Chromosome 2 (position 42557574)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAATCATCAAAGATTCCTTAAACCCTAGGTGGAATGAAGTATACGAG[G/A]TGGGTTTTTAGCGTCTAAGTGTCTTTCTGAAATAATTTTTTGAACTAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4xt1gd44