ddx18

Ensembl ID:
ENSDARG00000030789
ZFIN ID:
ZDB-GENE-030131-9685
Description:
ATP-dependent RNA helicase DDX18 [Source:RefSeq peptide;Acc:NP_001003411]
Human Orthologue:
DDX18
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 [Source:HGNC Symbol;Acc:2741]
Mouse Orthologue:
Ddx18
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 Gene [Source:MGI Symbol;Acc:MGI:1914192]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15400 Nonsense Available for shipment Available now
sa31736 Essential Splice Site Available for shipment Available now
sa31737 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048753 Nonsense 22 653 1 14
Genomic Location (Zv9):
Chromosome 9 (position 39367454)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38505350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGAAGATTCTTCGCAAGAAAATTCAAAAGAKAAGCGAAAAAAATAAA[C/T]AACGCAAACTGCTGCAATCTCAGAAAGAAGAAGAAAACAGCGAAGGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048753 Essential Splice Site 233 653 5 14
Genomic Location (Zv9):
Chromosome 9 (position 39370687)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38508583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCCTCAATTGAGCTTATCTATAAACTGAAATTCATGCCTAGAAATGG[T/A]AAGTGGATTTTCTGACATTTATAGATGATCTATAATGGAGGTCCCAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048753 Splice Site, Nonsense 547 653 13 14
Genomic Location (Zv9):
Chromosome 9 (position 39403234)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38541130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGGTTTTAAAATGGAATATGTGGTATCTGCTTTCATCTTTTTCAGT[T/A]GGATAAACTGATCGAGAAAAACTACTACCTTCACAAATCAGCTCAGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link