LOC565839

Ensembl ID:
ENSDARG00000030782
Human Orthologue:
EXOC3L2
Human Description:
exocyst complex component 3-like 2 [Source:HGNC Symbol;Acc:30162]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14042 Nonsense Available for shipment Available now
sa42528 Nonsense Mutation detected in F1 DNA During 2016
sa42527 Nonsense Mutation detected in F1 DNA During 2016
sa35866 Nonsense Mutation detected in F1 DNA During 2016
sa35865 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048183 Nonsense 241 861 3 12
Genomic Location:
Chromosome 15 (position 19120313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCAGTATTGGAAATYCTGCAGTTGGTGACAAAACGWGATTTGTTTT[T/A]GGCTGACACTCACATTCTGGAACTGGAGCAGGAGTGCAGAGAGGCCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048183 Nonsense 411 861 3 12
Genomic Location:
Chromosome 15 (position 19119802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTATATCCTGCCGAATATGACTCCTTCCAAGTGTATACACAGAGCTA[C/A]CATCAGGCCGTGACTCGCCGACTCCAGGCTCTCACCAACGGAGATCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048183 Nonsense 536 861 6 12
Genomic Location:
Chromosome 15 (position 19111146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGCTACAGGAGGATCTTGAGAGATCTGCGGCTGTAAACAGACATT[T/A]GGGTTCACGGGTTGCACAGTGCAGTCTCAATGGACTGGCAGATTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048183 Nonsense 588 861 7 12
Genomic Location:
Chromosome 15 (position 19109167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAATGAAGATGGTTACATCGCTAAAACCATTGCCCTTGCCAACTGCTG[T/A]CCATCGTTCAGGTTTGCCCCCTCAACAAGTCATTTTACATTGCAAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048183 Nonsense 746 861 11 12
Genomic Location:
Chromosome 15 (position 19103339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAATCTTCAGCCTCCTGGCTCGACAGCGCTATTCCTCACCTTTCA[G/T]AGATCATTCTCTTGGAAGACACTCCCTCCATCCAGATGGAAGTTGGCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link