ARHGEF25 (1 of 2)

Ensembl ID:
ENSDARG00000030766
Description:
Rho guanine nucleotide exchange factor (GEF) 25 [Source:HGNC Symbol;Acc:30275]
Human Orthologue:
ARHGEF25
Human Description:
Rho guanine nucleotide exchange factor (GEF) 25 [Source:HGNC Symbol;Acc:30275]
Mouse Orthologue:
D10Ertd610e
Mouse Description:
DNA segment, Chr 10, ERATO Doi 610, expressed Gene [Source:MGI Symbol;Acc:MGI:1277173]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39412 Nonsense Mutation detected in F1 DNA During 2016
sa37736 Nonsense Mutation detected in F1 DNA During 2016
sa37737 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15460 Nonsense Available for shipment Available now
sa12815 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048694 Nonsense 137 685 3 16
Genomic Location (Zv9):
Chromosome 23 (position 28213549)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28043735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGTTTTAAAGCAGTCTTGTGTACGTGTGTTTTGTGTGTGTAGGAGTG[G/A]AAAGATGGACTGCCTGCTCTTGGTGACTGTGATCCAGGTCTCCTGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048694 Nonsense 286 685 7 16
Genomic Location (Zv9):
Chromosome 23 (position 28231695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTAGTTATTTCCTGGCCGAGCTGGAGAAATGTGTGGCCGAGCCTGAA[C/T]GACTGGCGCAACTTTTTATCAAACATGTGAGTGTGTCTCTTTTTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048694 Essential Splice Site 324 685 8 16
Genomic Location (Zv9):
Chromosome 23 (position 28239421)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28069310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTAAATCTGAGCACATCGTGTCAGAATACATCGAGACCTACTTTGAG[G/A]TAAGTGCATGTCAAGGGCAAGCAGAAGATTATTGGAGTTCTCAAAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048694 Nonsense 436 685 12 16
ENSDART00000048694 Nonsense 436 685 12 16
Genomic Location (Zv9):
Chromosome 23 (position 28248481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28078520
KASP Assay ID:
2261-7904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCAGCATCCTGTCCCGCGCTAAAGAGAGACGRGTCTTCCTGTTTGAA[C/T]AACTTGTCATCTTTAGCGAGCCAATYGACAGGAAGAAAGGATTTTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048694 Nonsense 436 685 12 16
ENSDART00000048694 Nonsense 436 685 12 16
Genomic Location (Zv9):
Chromosome 23 (position 28248481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28078520
KASP Assay ID:
2261-7904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCAGCATCCTGTCCCGCGCTAAAGAGAGACGGGTCTTCCTGTTTGAA[C/T]AACTTGTCATCTTTAGCGAGCCAATYGACAGGAAGAAAGGATTTTCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link