hadh

Ensembl ID:
ENSDARG00000030765
ZFIN ID:
ZDB-GENE-040801-261
Description:
hydroxyacyl-coenzyme A dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001003515]
Human Orthologue:
HADH
Human Description:
hydroxyacyl-CoA dehydrogenase [Source:HGNC Symbol;Acc:4799]
Mouse Orthologue:
Hadh
Mouse Description:
hydroxyacyl-Coenzyme A dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:96009]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38294 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050603 Nonsense 39 309 1 8

The following transcripts of ENSDARG00000030765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50425808)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49274899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAACATGTCACGGTTATTGGAGGTGGGCTGATGGGCGCTGGTATTGCA[C/T]AAGTAAGTTATCGTAAACGAAACACGGCAACTGCATTCAGCGGCAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link