melk

Ensembl ID:
ENSDARG00000030759
ZFIN IDs:
ZDB-GENE-990603-5, ZDB-GENE-990603-5
Description:
maternal embryonic leucine zipper kinase [Source:RefSeq peptide;Acc:NP_996771]
Human Orthologue:
MELK
Human Description:
maternal embryonic leucine zipper kinase [Source:HGNC Symbol;Acc:16870]
Mouse Orthologue:
Melk
Mouse Description:
maternal embryonic leucine zipper kinase Gene [Source:MGI Symbol;Acc:MGI:106924]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19483 Nonsense Available for shipment Available now
sa11312 Nonsense Available for shipment Available now
sa14613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047728 Nonsense 130 676 5 18
ENSDART00000125259 Nonsense 130 676 4 17
Genomic Location:
Chromosome 1 (position 20714933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCGCCAGATCATCTCTGCGTTGGCCTATGTTCATAGCCAAGGTTA[T/A]GCCCATCGAGACCTCAAACCTGTGAGTTTGTCTTTGAAAAAGGGTTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047728 Nonsense 269 676 10 18
ENSDART00000125259 Nonsense 269 676 9 17
Genomic Location:
Chromosome 1 (position 20710545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTTGACAKTGAAACATTTGCTTGATCACCCATGGGTTATGAGGGGCTA[C/A]AGCACACCAGTGGAGTGGCACAGTAAATATCCAGTAAGATCAGCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047728 Nonsense 298 676 11 18
ENSDART00000125259 Nonsense 298 676 10 17
Genomic Location:
Chromosome 1 (position 20709571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTCATATAGATGAAGACTGCATCACAGAAATGGCGGTGACTTWCAAA[C/T]AGTCCAAACAACGAACTATCCAGCTTGTGTCTGAGGTAGAGGAATTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ia2nued0