dnmt1

Ensembl ID:
ENSDARG00000030756
ZFIN IDs:
ZDB-GENE-990714-15, ZDB-GENE-990714-15, ZDB-GENE-990714-15
Description:
DNA (cytosine-5)-methyltransferase 1 [Source:RefSeq peptide;Acc:NP_571264]
Human Orthologue:
DNMT1
Human Description:
DNA (cytosine-5-)-methyltransferase 1 [Source:HGNC Symbol;Acc:2976]
Mouse Orthologue:
Dnmt1
Mouse Description:
DNA methyltransferase (cytosine-5) 1 Gene [Source:MGI Symbol;Acc:MGI:94912]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40174 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40173 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16282 Essential Splice Site Available for shipment Available now
sa40172 Nonsense Mutation detected in F1 DNA During 2017
sa20150 Nonsense Available for shipment Available now
sa40171 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Essential Splice Site 227 1500 8 34
ENSDART00000078973 Essential Splice Site 227 1499 8 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55454620)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54348346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGAAGCTGAGAATGCTGCTAACCTCAAACCTGTGTCTACAGCAAAG[G/A]TGACGCTTCTTTTCACTTCCAATTTGATTTGCCACTTGAATTAATAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Essential Splice Site 227 1500 8 34
ENSDART00000078973 Essential Splice Site 227 1499 8 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55454619)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54348345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGAAGCTGAGAATGCTGCTAACCTCAAACCTGTGTCTACAGCAAAGG[T/C]GACGCTTCTTTTCACTTCCAATTTGATTTGCCACTTGAATTAATAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Essential Splice Site 413 1500 13 34
ENSDART00000078973 Essential Splice Site 413 1499 13 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55453601)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54347327
KASP Assay ID:
2259-4164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAAAAACCAGGATGCYACRTATGAGGACCTGCTGAACAAAATAGAGG[T/C]ACAMTTTATGGRAGYRTTGAAGTTCTTTGCCACTTGTCCYATTTTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Nonsense 563 1500 16 34
ENSDART00000078973 Nonsense 563 1499 16 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55452192)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54345918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGCTTGTAAGGATATGATCAAGTTTGGAGGCAGTGGCAGAAGTAAA[C/T]AAGCCTGTCAGAAGAGGAGGTATGCTTACTGTGCAGTCTTTGCTGTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Nonsense 698 1500 19 34
ENSDART00000078973 Nonsense 698 1499 19 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55449605)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54343331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTTGGAGAGTCATCAGACCCTCTTGAGCTCTTCCTAGTGGATGAGTG[T/A]GAAGACATGCAGCTAAGTTTTATCCATGGCAAGGTCAACGTCTTCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021977 Nonsense 1016 1500 25 34
ENSDART00000078973 Nonsense 1015 1499 27 36
ENSDART00000128041   None 200 None 9
Genomic Location (Zv9):
Chromosome 3 (position 55448044)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54341770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGGGAAAGGGAAAGCAGCGCCTCAAGAACCACAGGATCAGGAGCCA[C/T]AAGAGCCAGTGGTTCCCAAACTGCGCACTCTGGATGTATTCTCTGGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link