xirp1

Ensembl ID:
ENSDARG00000030722
ZFIN ID:
ZDB-GENE-050221-2
Description:
Xin actin-binding repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5PZ43]
Human Orthologue:
XIRP1
Human Description:
xin actin-binding repeat containing 1 [Source:HGNC Symbol;Acc:14301]
Mouse Orthologue:
Xirp1
Mouse Description:
xin actin-binding repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1333878]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39826 Nonsense Mutation detected in F1 DNA During 2016
sa14052 Nonsense Available for shipment Available now
sa12194 Nonsense Available for shipment Available now
sa39827 Nonsense Mutation detected in F1 DNA During 2016
sa16645 Nonsense Available for shipment Available now
sa46 Nonsense Available for shipment Available now
sa32918 Nonsense Mutation detected in F1 DNA During 2016
sa32919 Nonsense Mutation detected in F1 DNA During 2016
sa2039 Nonsense F2 line generated During 2016
sa32920 Nonsense Mutation detected in F1 DNA During 2016
sa32921 Nonsense Mutation detected in F1 DNA During 2016
sa39828 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 7 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24106979)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24101516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGAGCCTTCATACTTCTTTGCCCCCAAGATGGCAGAAGTAGCCAAA[C/T]AGAAAAAAGCTACAGAAGCAGTCTGTGGAGATGAGGATTTCCCTCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 61 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24107141)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24101354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCCCCGTACCACCTCCAAAAGAAACCTTCTCAGAGATCTACCAACAR[C/T]GAYAAAAAAGTGAACTGAAGCGCCTTTTTAAACACATCCACCCTGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 62 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24107144)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24101351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCGTACCACCTCCAAAAGAAACCTTCTCAGAGATCTACCAACARYGA[C/T]AAAAAAGTGAACTGAAGCGCCTTTTTAAACACATCCACCCTGAACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 149 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24107405)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24101090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGAAAATCCTCAAGGTGGGGATGTGAAGGGCAAATCCTCTTTGTTT[G/T]AGCATTCAACATTCGACAGTCAGCATGCAGCAGGTGCCGAGAGAGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 239 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24107676)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24100819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTCTTTAGGTCGCKGCTGCTCTRTCGAAGACCAACATTTCCTAACAT[T/A]AAAATCAGAACTCCAAGAGAACAAAGGAGATGTGAAGAAAACAGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa46
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 271 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24107771)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24100724
KASP Assay ID:
554-0064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACTTTTTCAAGCAGATCCCTGTTGTGCGCTTAGGGATAGCAATGGT[A/T]AAATCCATGAAATCAAATCAATCTGCAGAGAAGAAATCATGAGCAGTGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 966 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24109858)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24098637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGAGCGTTACAGATGTTCAACAAGGTGATGTACGTACCTCAACCTG[G/A]CTTTTTGAGAATCAGCCTATTGATACTCTAAAAGGTGAACCAGATGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 991 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24109931)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24098564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCTAAAAGGTGAACCAGATGAGCAGAACAACTTGACAGCTGTACAT[A/T]GAGAAGATAACACTAAGGGAGATGTGAAACGCTGCACTTGGTTGTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2039
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 1380 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24111098)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24097397
KASP Assay ID:
554-2693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGGAGACATTAAGGCAACACTTGAATCCTTGGAGCGAGCTAAACAA[C/T]AAAGCATGCAGGTGGAGCGTGAAGTCATAAAACCAGGCACCATTTATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 1865 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24112553)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24095942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAACTACAGACACAGGCTCACCTTTCCCGAAGAAAATTAAAGTTGTG[C/T]AAAAAGAAAACATTCAGGAACAGGCTAAAACCTCCAATAAAGATGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 1874 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24112580)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24095915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGAAGAAAATTAAAGTTGTGCAAAAAGAAAACATTCAGGAACAGGCT[A/T]AAACCTCCAATAAAGATGAGTTACACTTCACCAGCAGAGACACCTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 2015 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24113003)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24095492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCGTCCGAGAGTTGCCAAAGAGACGGAGGGCTTAAGAGATGATCTA[G/T]AGAGCATATCTTCAGTTGAGGCTGCATTTGAGGACCTAGAAAAAGCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link