xirp1

Ensembl ID:
ENSDARG00000030722
ZFIN ID:
ZDB-GENE-050221-2
Description:
Xin actin-binding repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5PZ43]
Human Orthologue:
XIRP1
Human Description:
xin actin-binding repeat containing 1 [Source:HGNC Symbol;Acc:14301]
Mouse Orthologue:
Xirp1
Mouse Description:
xin actin-binding repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1333878]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14052 Nonsense Available for shipment Available now
sa12194 Nonsense Available for shipment Available now
sa16645 Nonsense Available for shipment Available now
sa46 Nonsense Available for shipment Available now
sa2039 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 61 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24107141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCCCCGTACCACCTCCAAAAGAAACCTTCTCAGAGATCTACCAACAR[C/T]GAYAAAAAAGTGAACTGAAGCGCCTTTTTAAACACATCCACCCTGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 62 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24107144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCGTACCACCTCCAAAAGAAACCTTCTCAGAGATCTACCAACARYGA[C/T]AAAAAAGTGAACTGAAGCGCCTTTTTAAACACATCCACCCTGAACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 239 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24107676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTCTTTAGGTCGCKGCTGCTCTRTCGAAGACCAACATTTCCTAACAT[T/A]AAAATCAGAACTCCAAGAGAACAAAGGAGATGTGAAGAAAACAGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa46
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 271 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24107771)
KASP Assay ID:
554-0064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACTTTTTCAAGCAGATCCCTGTTGTGCGCTTAGGGATAGCAATGGT[A/T]AAATCCATGAAATCAAATCAATCTGCAGAGAAGAAATCATGAGCAGTGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2039
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042413 Nonsense 1380 2297 1 1

The following transcripts of ENSDARG00000030722 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24111098)
KASP Assay ID:
554-2693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGGAGACATTAAGGCAACACTTGAATCCTTGGAGCGAGCTAAACAA[C/T]AAAGCATGCAGGTGGAGCGTGAAGTCATAAAACCAGGCACCATTTATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b40om05v