ing4

Ensembl ID:
ENSDARG00000030716
ZFIN ID:
ZDB-GENE-050522-47
Description:
inhibitor of growth protein 4 [Source:RefSeq peptide;Acc:NP_001018304]
Human Orthologue:
ING4
Human Description:
inhibitor of growth family, member 4 [Source:HGNC Symbol;Acc:19423]
Mouse Orthologue:
Ing4
Mouse Description:
inhibitor of growth family, member 4 Gene [Source:MGI Symbol;Acc:MGI:107307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36787 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045245 Nonsense 173 250 6 8
Genomic Location (Zv9):
Chromosome 19 (position 10139449)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9597988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCCAAATTCTCAACTAGTATTTTTATTCCTTCCAGCACTGAGTTTT[C/A]AACTCCAGCTGTGAACTTTGGGAACGTGCATCCCTCTGATGTGTTGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link