otx1a

Ensembl ID:
ENSDARG00000030703
ZFIN ID:
ZDB-GENE-980526-27
Description:
Homeobox protein OTX1 A [Source:UniProtKB/Swiss-Prot;Acc:Q90267]
Human Orthologues:
OTX1, OTX2
Human Descriptions:
orthodenticle homeobox 1 [Source:HGNC Symbol;Acc:8521]
orthodenticle homeobox 2 [Source:HGNC Symbol;Acc:8522]
Mouse Orthologues:
Otx1, Otx2
Mouse Descriptions:
orthodenticle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97450]
orthodenticle homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19590 Nonsense Mutation detected in F1 DNA During 2014
sa12472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006538 Nonsense 31 338 2 4
Genomic Location:
Chromosome 1 (position 51433527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGGCTCGGCGGGGCAACCATGGACCTCCTGCATCCCTCTGTGGGATA[T/A]CCCAGTAAGAGCATCACATTTCTTTATGCAAAAGAGCAAGTAAATATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006538 Nonsense 85 338 4 4
Genomic Location:
Chromosome 1 (position 51438171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGACACCCTGAATAACCCATGTTGTATTTTWTAATGAACAGGTTTG[G/A]TTYAAAAACAGAAGAGCWAAGTGTCGCCAGCAGCAGCAGCAGAGCAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/61nvyw4l