ctps

Ensembl ID:
ENSDARG00000030700
ZFIN ID:
ZDB-GENE-030131-808
Description:
CTP synthase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEI7]
Human Orthologue:
CTPS
Human Description:
CTP synthase [Source:HGNC Symbol;Acc:2519]
Mouse Orthologue:
Ctps
Mouse Description:
cytidine 5'-triphosphate synthase Gene [Source:MGI Symbol;Acc:MGI:1858304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7452 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017330 Missense 121 591 4 19
ENSDART00000129650 Missense 125 595 3 18
ENSDART00000131319 Missense 125 595 4 19
Genomic Location:
Chromosome 19 (position 15451124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTTGTTTATTCATTTGTTCCAGTGGTGCCACACATAACTGATGCTA[T/A]CCAGGAGTGGGTGATGCGTCAAGCCAAAATTCCTGTAGATGATGATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nkpwnlz8