PHKA2

Ensembl ID:
ENSDARG00000030687
Description:
phosphorylase kinase, alpha 2 (liver) [Source:HGNC Symbol;Acc:8926]
Human Orthologue:
PHKA2
Human Description:
phosphorylase kinase, alpha 2 (liver) [Source:HGNC Symbol;Acc:8926]
Mouse Orthologue:
Phka2
Mouse Description:
phosphorylase kinase alpha 2 Gene [Source:MGI Symbol;Acc:MGI:97577]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14109 Nonsense Available for shipment Available now
sa21943 Essential Splice Site Available for shipment Available now
sa10546 Nonsense Available for shipment Available now
sa16397 Essential Splice Site Available for shipment Available now
sa11966 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078202 Nonsense 240 1161 9 32
Genomic Location (Zv9):
Chromosome 11 (position 34739205)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33640142
KASP Assay ID:
2260-4502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGCTTTTTCATTTCATGKTTAKAACAGGACCCYACTYGAYTTCACTA[T/G]GACCCTGCCGAGCTGAAGCTCTTTGARAACATTGAATGTGAATGGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078202 Essential Splice Site 413 1161 13 32
Genomic Location (Zv9):
Chromosome 11 (position 34736585)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33637522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCGGGTTATGCCAGCTCGCATCCTGAGCCACATTTATGTGAAACTGG[G/A]TGAGTGTTCAGATCCAGATGGCGTAAATGAGGATATCTGTGAAATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078202 Nonsense 424 1161 14 32
Genomic Location (Zv9):
Chromosome 11 (position 34736479)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33637416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCTTTTTBNCTTTYCACAGGAAACTGTAAAAAACTSAACTTGAGTGGA[C/T]GACCGTACAGGCACATTGGCGTTCTGGGAACTTCAAAGTTTTATGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078202 Essential Splice Site 450 1161 14 32
Genomic Location (Zv9):
Chromosome 11 (position 34736398)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33637335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAAATGGCACTTACACTTTTACTCCACAG[G/T]TAAGWGAAATTTCTGCCTTGAAAYTCTTTAGAAAGAAAAKATTAWCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078202 Essential Splice Site 713 1161 21 32
Genomic Location (Zv9):
Chromosome 11 (position 34723442)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33624379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACCCTGCAGGAYCAGGCCGATAWCCTCTATGTCCTCTATGCTATGAA[G/A]TGAGAGACTATTGTGCATATCTATTTTGATWTCTGCTTCATCCAATAGTY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link