sept3

Ensembl ID:
ENSDARG00000030656
ZFIN ID:
ZDB-GENE-050522-375
Description:
Neuronal-specific septin-3 [Source:UniProtKB/Swiss-Prot;Acc:A2BGU8]
Human Orthologue:
SEPT3
Human Description:
septin 3 [Source:HGNC Symbol;Acc:10750]
Mouse Orthologue:
Sept3
Mouse Description:
septin 3 Gene [Source:MGI Symbol;Acc:MGI:1345148]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25647 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10682 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044057 Essential Splice Site 196 361 5 10
ENSDART00000128383 Essential Splice Site 196 361 4 9
ENSDART00000044057 Essential Splice Site 196 361 5 10
ENSDART00000128383 Essential Splice Site 196 361 4 9
Genomic Location (Zv9):
Chromosome 1 (position 46094816)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44932328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACCAGAGTGCACTGCTGCTTGTATTTCATATCCCCTACTGGACATTC[G/T]TGAGTTTACATACCAACATTTTACTCATTACTCCATACCTACTAGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044057 Essential Splice Site 196 361 5 10
ENSDART00000128383 Essential Splice Site 196 361 4 9
ENSDART00000044057 Essential Splice Site 196 361 5 10
ENSDART00000128383 Essential Splice Site 196 361 4 9
Genomic Location (Zv9):
Chromosome 1 (position 46094816)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44932328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYACCAGAGTGCACTGCTGCTTGTATTTCATATCCCCTACTGGACATTC[G/A]TGAGTTTACATACCAACATTTTACTYATTACTCCATACCTACTAGATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link