gnai3

Ensembl ID:
ENSDARG00000030644
ZFIN ID:
ZDB-GENE-070713-6
Description:
guanine nucleotide-binding protein G(k) subunit alpha [Source:RefSeq peptide;Acc:NP_001104720]
Human Orthologues:
GNAI1, GNAI3
Human Descriptions:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 [Source:HGNC
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 [Source:HGNC
Mouse Orthologues:
Gnai1, Gnai3
Mouse Descriptions:
guanine nucleotide binding protein (G protein), alpha inhibiting 1 Gene [Source:MGI Symbol;Acc:MGI:9
guanine nucleotide binding protein (G protein), alpha inhibiting 3 Gene [Source:MGI Symbol;Acc:MGI:9

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047528 Nonsense 211 354 6 9
ENSDART00000136505 Nonsense 159 188 6 6
Genomic Location (Zv9):
Chromosome 8 (position 26068082)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25196000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAAAAGGATGTTTGATGTGGGTGGCCAGCGTTCTGAGCGGAAGAAGTG[G/A]ATTCATTGTTTTGAAGGAGTCACTGCCATCATCTTCTGTGTGGCGCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link