pdlim7

Ensembl ID:
ENSDARG00000030638
ZFIN ID:
ZDB-GENE-040426-2092
Description:
Pdlim7 protein [Source:UniProtKB/TrEMBL;Acc:Q6NWL9]
Human Orthologue:
PDLIM7
Human Description:
PDZ and LIM domain 7 (enigma) [Source:HGNC Symbol;Acc:22958]
Mouse Orthologue:
Pdlim7
Mouse Description:
PDZ and LIM domain 7 Gene [Source:MGI Symbol;Acc:MGI:1914649]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39012 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42442 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044909 Essential Splice Site 142 393 7 13
ENSDART00000108970   None 207 None 10
Genomic Location (Zv9):
Chromosome 14 (position 47606229)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150637.1 22311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTACATTCTTTTGCCCCCAGAAAAATTTTAGCATATTGCATTAAAA[G/A]TGAGGTATGTAAGTTTTAGACTTTTCTAAAGCAGAAAAACACTGTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044909 Nonsense 256 393 11 13
ENSDART00000108970   None 207 None 10
Genomic Location (Zv9):
Chromosome 14 (position 47593176)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150637.1 9258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCGCTGAAGTCTTTTGTGTTGCTGCTGTGTGTTTTAGGGGACGGTA[C/A]GTGGTGGCGCTGGGCCGCTCCTGGCACCCGGAGGAGTTCATGTGCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link