si:dkey-159b16.1

Ensembl ID:
ENSDARG00000030633
ZFIN ID:
ZDB-GENE-070912-382
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYC9]
Human Orthologue:
PLEKHM3
Human Description:
pleckstrin homology domain containing, family M, member 3 [Source:HGNC Symbol;Acc:34006]
Mouse Orthologue:
Plekhm3
Mouse Description:
pleckstrin homology domain containing, family M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2443627]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17447 Nonsense Available for shipment Available now
sa34662 Nonsense Mutation detected in F1 DNA During 2017
sa13274 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046880 Nonsense 169 711 2 7
Genomic Location (Zv9):
Chromosome 9 (position 29193543)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28349239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACAAGGAGAGCAGCTCTTACCTGGTGAAGCAGGGAACTCTAGAACAG[C/T]GAGAAGGCCCGTGGGGACGGTGGACYGCCTGYCATGTGGAGCTTACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046880 Nonsense 254 711 2 7
Genomic Location (Zv9):
Chromosome 9 (position 29193798)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28349494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACCCTGCCAGTGGGAGGCACTGGAGTGGCGTAGACTCCTCTGGGAA[C/T]GAGTCTTGGCCGCCCGTCCCACTCACAGCAAAGCGGAGCCAGCTTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046880 Nonsense 452 711 2 7
Genomic Location (Zv9):
Chromosome 9 (position 29194394)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28350090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCTAAACGGCAGTCTGTCACAACTAGCTTTCTYAGCATCCTTACCTG[T/A]CTGGCCGTAGAAAAGGGCCTCACTGCTCAGAGCTTCCGATGTGCAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link