mfsd2aa

Ensembl ID:
ENSDARG00000030630
ZFIN ID:
ZDB-GENE-041114-166
Description:
Major facilitator superfamily domain-containing protein 2A-A [Source:UniProtKB/Swiss-Prot;Acc:Q5U3U7
Human Orthologue:
MFSD2A
Human Description:
major facilitator superfamily domain containing 2A [Source:HGNC Symbol;Acc:25897]
Mouse Orthologue:
Mfsd2a
Mouse Description:
major facilitator superfamily domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1923824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38960 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046115 Nonsense 56 532 2 14
Genomic Location (Zv9):
Chromosome 13 (position 36332718)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35805287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGACTGTGTGGAGTAAGGTGTGTTTTGCGATCGGAGGGGCTCCGTA[T/A]CAGATCACAGGCACCGCCCTGGGCTTCTTTCTACAAATCTTCTTGCTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link