th

Ensembl ID:
ENSDARG00000030621
ZFIN ID:
ZDB-GENE-990621-5
Description:
tyrosine 3-monooxygenase [Source:RefSeq peptide;Acc:NP_571224]
Human Orthologue:
TH
Human Description:
tyrosine hydroxylase [Source:HGNC Symbol;Acc:11782]
Mouse Orthologue:
Th
Mouse Description:
tyrosine hydroxylase Gene [Source:MGI Symbol;Acc:MGI:98735]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1635 Essential Splice Site F2 line generated During 2014
sa4299 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1635
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Essential Splice Site 360 489 10 13
ENSDART00000044624 Essential Splice Site None 110 9 12
Genomic Location:
Chromosome 25 (position 24783281)
KASP Assay ID:
554-1575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCATCTCTTGGAGCTTCTGATGAAGATATTGAGAAGCTATCGACAG[T/A]AAGTATAAATCATCTCAAAGCTTATGAAACTCAGTATTTTAYATGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Nonsense 412 489 12 13
ENSDART00000044624 None None 110 11 12
Genomic Location:
Chromosome 25 (position 24781144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGATGAGCCAGAGAGACGAGAATTTGACCCAGATATTGTTGCTGTT[C/T]AGCCATACCAAGACCAGACTTACCAACCTGTCTATTTTGTGTCAGAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Identification of seven new prostate cancer susceptibility loci through a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3rtju8zm