th

Ensembl ID:
ENSDARG00000030621
ZFIN ID:
ZDB-GENE-990621-5
Description:
tyrosine 3-monooxygenase [Source:RefSeq peptide;Acc:NP_571224]
Human Orthologue:
TH
Human Description:
tyrosine hydroxylase [Source:HGNC Symbol;Acc:11782]
Mouse Orthologue:
Th
Mouse Description:
tyrosine hydroxylase Gene [Source:MGI Symbol;Acc:MGI:98735]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38085 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1635 Essential Splice Site F2 line generated During 2016
sa4299 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Essential Splice Site 97 489 3 13
ENSDART00000044624 Essential Splice Site 4 110 2 12
Genomic Location:
Chromosome 25 (position 24793346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGCACTATTTTCATAATATTTATTTTATTATATCAATTGAACACCAC[A/T]GACATTTGAGGCCAAAATCCACCATCTTGAAACCAGACCCAGCCGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1635
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Essential Splice Site 360 489 10 13
ENSDART00000044624 Essential Splice Site None 110 9 12
Genomic Location:
Chromosome 25 (position 24783281)
KASP Assay ID:
554-1575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCATCTCTTGGAGCTTCTGATGAAGATATTGAGAAGCTATCGACAG[T/A]AAGTATAAATCATCTCAAAGCTTATGAAACTCAGTATTTTAYATGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040410 Nonsense 412 489 12 13
ENSDART00000044624   None 110 11 12
Genomic Location:
Chromosome 25 (position 24781144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGATGAGCCAGAGAGACGAGAATTTGACCCAGATATTGTTGCTGTT[C/T]AGCCATACCAAGACCAGACTTACCAACCTGTCTATTTTGTGTCAGAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Identification of seven new prostate cancer susceptibility loci through a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link