nfe2l1

Ensembl ID:
ENSDARG00000030616
ZFIN ID:
ZDB-GENE-040630-5
Description:
nuclear factor erythroid 2-like 1 [Source:RefSeq peptide;Acc:NP_998020]
Human Orthologue:
NFE2L1
Human Description:
nuclear factor (erythroid-derived 2)-like 1 [Source:HGNC Symbol;Acc:7781]
Mouse Orthologue:
Nfe2l1
Mouse Description:
nuclear factor, erythroid derived 2,-like 1 Gene [Source:MGI Symbol;Acc:MGI:99421]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26053 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030825 Nonsense 151 705 2 9
ENSDART00000103982 Nonsense 151 707 2 6
ENSDART00000124133 Nonsense 151 707 1 5
Genomic Location (Zv9):
Chromosome 3 (position 24374488)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23952699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGAGGCTGGGAAGCGGAGGAGAACTGAGCTATGAAGTAGCTGAGGAT[C/T]AAAGCCTTGAAGCTTTCATGTCAAGAAGCCTCAACCATCCAGATGACGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link