rhogd

Ensembl ID:
ENSDARG00000030608
ZFIN ID:
ZDB-GENE-040426-1504
Description:
ras homolog gene family, member Ga [Source:RefSeq peptide;Acc:NP_956974]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13234 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049136 Nonsense 23 191 1 1
ENSDART00000129953 Nonsense 23 191 2 2
ENSDART00000146521 Nonsense 23 191 2 2

The following transcripts of ENSDARG00000030608 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 12431177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGGTGGGAGACGGTGCGGTAGGCAAGACATGCCTTCTTATTTCTTA[T/A]ACGACAAATGCCTTTCCAGAGGAGTACATTCCCACAGTGTTTRACAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uze93klt