lrrc42

Ensembl ID:
ENSDARG00000030591
ZFIN ID:
ZDB-GENE-030131-4992
Description:
Leucine-rich repeat-containing protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6P5J6]
Human Orthologue:
LRRC42
Human Description:
leucine rich repeat containing 42 [Source:HGNC Symbol;Acc:28792]
Mouse Orthologue:
Lrrc42
Mouse Description:
leucine rich repeat containing 42 Gene [Source:MGI Symbol;Acc:MGI:1925059]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18299 Essential Splice Site Available for shipment Available now
sa15849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045056 Essential Splice Site 323 407 6 7
Genomic Location:
Chromosome 2 (position 26758067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTGCCAAAGAAWGACCCCAAAYCAAGAACAAATGCCCTTCGTTTCTG[T/C]AAGTTTATTCATATTATTTATTATATTTGACTTTATATATTTAATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045056 Nonsense 336 407 7 7
Genomic Location:
Chromosome 2 (position 26758871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTTAGATGGAAGAGAAAAGTTYGTCAGAGARATGTTAAACTCCTG[G/A]TCTGAAACAAGTGACGCCACAAACAAAGATAAAGCTGTGCCCATTCACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0myj15q2