rpl13

Ensembl ID:
ENSDARG00000030585
ZFIN ID:
ZDB-GENE-031007-1
Description:
60S ribosomal protein L13 [Source:UniProtKB/Swiss-Prot;Acc:Q90Z10]
Human Orthologue:
RPL13
Human Description:
ribosomal protein L13 [Source:HGNC Symbol;Acc:10303]
Mouse Orthologues:
Gm10071, Rpl13, Rpl13-ps3
Mouse Descriptions:
predicted gene 10071 Gene [Source:MGI Symbol;Acc:MGI:3642685]
ribosomal protein L13 Gene [Source:MGI Symbol;Acc:MGI:105922]
ribosomal protein L13, pseudogene 3 Pseudogene [Source:MGI Symbol;Acc:MGI:3646682]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa638 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa638
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047391 Nonsense 31 211 2 6
Genomic Location:
Chromosome 7 (position 69523080)
KASP Assay ID:
554-0547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATAAAGACTGGCAGAAGAGAGTGCGCACCTGGTTCAACCAGCCTGCC[A/T]GAAAGATCCGCAGGTAATAAGTGTGTCCACACATGTGTTGAAGGTTTATG
Associated Phenotype:
Data not yet available
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
3:24490901-24492058 24492058 1 2.19 × 10-226 2.5 -2 atf4b2 ENSDARG00000038141
8:26078534-26079300 26078534 -1 6.09 × 10-214 -7.2 -1 gnat2 ENSDARG00000042529
6:269178-269600 269178 -1 4.80 × 10-179 -6.9 -2 pde6h ENSDARG00000070439
8:55706885-55707500 55706885 -1 4.80 × 10-179 -7.8 0 rho ENSDARG00000002193
25:35073801-35074187 35074187 1 2.68 × 10-169 2.4 -2 anxa2a ENSDARG00000003216

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vo7yiwjn