nudt1

Ensembl ID:
ENSDARG00000030573
ZFIN ID:
ZDB-GENE-040426-2757
Description:
7,8-dihydro-8-oxoguanine triphosphatase [Source:RefSeq peptide;Acc:NP_998583]
Human Orthologue:
NUDT1
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 1 [Source:HGNC Symbol;Acc:8048]
Mouse Orthologue:
Nudt1
Mouse Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 1 Gene [Source:MGI Symbol;Acc:MGI:109280]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11427 Essential Splice Site Available for shipment Available now
sa31351 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040753 Essential Splice Site None 156 1 4
Genomic Location (Zv9):
Chromosome 3 (position 42120281)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41983641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTACAAGTTATTACGTTCTGTCTCCAYAGGCTTCTTTGGACAAAG[T/C]AAGGATATTATTTGGATAAGAAGTAACCGTGAAAAAACCTTGACAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040753 Essential Splice Site 99 156 3 4
Genomic Location (Zv9):
Chromosome 3 (position 42116840)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41980200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATTTTTAGAGCTGACAACTATGAAGGAGAGCCAGCCGAATCAGACG[G/A]TAAAACAGCTCTATTGTCTGCTTTTTTTTTTTTTTAGACATTTGATGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link