rnd1

Ensembl ID:
ENSDARG00000030547
ZFIN ID:
ZDB-GENE-040630-6
Description:
Rho family GTPase 1 [Source:RefSeq peptide;Acc:NP_998019]
Human Orthologue:
RND1
Human Description:
Rho family GTPase 1 [Source:HGNC Symbol;Acc:18314]
Mouse Orthologue:
Rnd1
Mouse Description:
Rho family GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:2444878]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8640 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044986 Nonsense 184 232 5 5
ENSDART00000122654 Nonsense 184 232 5 6
Genomic Location (Zv9):
Chromosome 23 (position 17982802)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17885741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCGTTCACATCRGAGAAAAGCATCCACAGTGTGTTTCGCTCAGCAT[C/A]GCTCACGTGCCTAAACAAACTGCAGCCGCCCRTAAAGCAAAGCCCCACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link