psmc1a

Ensembl ID:
ENSDARG00000030537
ZFIN ID:
ZDB-GENE-030131-8730
Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 1 [Source:RefSeq peptide;Acc:NP_956327]
Human Orthologue:
PSMC1
Human Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 1 [Source:HGNC Symbol;Acc:9547]
Mouse Orthologue:
Psmc1
Mouse Description:
protease (prosome, macropain) 26S subunit, ATPase 1 Gene [Source:MGI Symbol;Acc:MGI:106054]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10453 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036668 Essential Splice Site 1 440 1 11
Genomic Location (Zv9):
Chromosome 17 (position 8771525)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8768867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCTACTAACATYAGTGCAGAAGAAGAAACAGCCGTCAAACGACAATG[G/A]TGAGCCAGCATATTTCATTTCTTTTCATTTTAAATTCCTTTTATGTKTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link