ARHGEF12 (1 of 2)

Ensembl ID:
ENSDARG00000030532
Description:
Rho guanine nucleotide exchange factor (GEF) 12 [Source:HGNC Symbol;Acc:14193]
Human Orthologue:
ARHGEF12
Human Description:
Rho guanine nucleotide exchange factor (GEF) 12 [Source:HGNC Symbol;Acc:14193]
Mouse Orthologue:
Arhgef12
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6375 Nonsense Mutation detected in F1 DNA During 2014
sa10278 Nonsense Available for shipment Available now
sa17338 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Nonsense 506 1357 18 39
Genomic Location:
Chromosome 15 (position 21469728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTTTGGTCTCTTCCAGCTCCACTATACAGTATGTGATCTTCATGTA[C/A]ATGAAGCATCTGGGAGTTCGGGCGAAAGARCARCGAAACCTGGAATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Nonsense 524 1357 18 39
Genomic Location:
Chromosome 15 (position 21469780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCATCTGGGAGTTCGGGCGAAAGARCARCGAAACCTGGAATCCAAA[C/T]GAGTTCGAATTAATTTCCTTCCTTCCAAACTAAGGGTATGTGCCATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040542 Essential Splice Site 698 1357 22 39
Genomic Location:
Chromosome 15 (position 21475284)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTAGACCTCCTGATGTGGGCACACCTAAACCGAGCAGAAG[G/A]TAATGGTCACTGCTTCTGTCAATCACTCACAKCACTCTAAATACACCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/09aoojpe