acsl1

Ensembl ID:
ENSDARG00000030514
ZFIN ID:
ZDB-GENE-050809-115
Description:
acyl-CoA synthetase long-chain family member 1 [Source:RefSeq peptide;Acc:NP_001027007]
Human Orthologue:
ACSL1
Human Description:
acyl-CoA synthetase long-chain family member 1 [Source:HGNC Symbol;Acc:3569]
Mouse Orthologue:
Acsl1
Mouse Description:
acyl-CoA synthetase long-chain family member 1 Gene [Source:MGI Symbol;Acc:MGI:102797]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11697 Essential Splice Site Available for shipment Available now
sa13904 Nonsense Available for shipment Available now
sa19462 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039917 Essential Splice Site 125 697 4 21
ENSDART00000125125 Essential Splice Site 125 697 4 21
ENSDART00000146946 None 125 125 4 4

The following transcripts of ENSDARG00000030514 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16297838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGTCGCGAAAGGCAGGCCAGCCATATAAATGGCTGTCRTATAAGGAG[G/A]TAAGATTTGTGAAATAATTATTGACCTAATTGCAGAACGCATTTAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039917 Nonsense 212 697 7 21
ENSDART00000125125 Nonsense 212 697 7 21
ENSDART00000146946 None None 125 None 4

The following transcripts of ENSDARG00000030514 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16296041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACYACCATCATCTGTGACATCGCGGATAAAGCTCGTCTGATCCTGGACTG[T/A]GTGTCTGGCCGGAAGCACAGCGTCACGACTATAGTKATCATGGAGAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039917 Nonsense 614 697 19 21
ENSDART00000125125 Nonsense 614 697 19 21
ENSDART00000146946 None None 125 None 4

The following transcripts of ENSDARG00000030514 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16284825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTTGTGGTTCCTGATCCAGACTTTTTGCCAGGATGGGCAAAGAAT[A/T]GAGGCATTGAGGGATCCTTCAATGACTTGTGCAAAAGCAAGGTAAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ge9jdx5q