il6st

Ensembl ID:
ENSDARG00000030498
ZFIN ID:
ZDB-GENE-080104-6
Description:
interleukin-6 receptor subunit beta [Source:RefSeq peptide;Acc:NP_001106976]
Human Orthologue:
IL6ST
Human Description:
interleukin 6 signal transducer (gp130, oncostatin M receptor) [Source:HGNC Symbol;Acc:6021]
Mouse Orthologue:
Il6st
Mouse Description:
interleukin 6 signal transducer Gene [Source:MGI Symbol;Acc:MGI:96560]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21663 Nonsense Mutation detected in F1 DNA During 2014
sa1462 Nonsense Available for shipment Available now
sa21662 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7643 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 387 866 8 15
ENSDART00000122516 Nonsense 380 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location:
Chromosome 10 (position 7793914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAATGTGTAACTATTCCCTGATCATCAGTCAAGATAACCAGGCTTTT[G/T]AAAGTCACGTTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 407 866 8 15
ENSDART00000122516 Nonsense 400 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location:
Chromosome 10 (position 7793854)
KASP Assay ID:
554-1387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAAAAGCTGATCAGCTCAACCAGAGGTATTCACTGGAAGTGCCACCA[G/T]AAGAAAATGCCAGTATTGAAATAACTGCATTCAATTCAGCCGGAGGGTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Essential Splice Site 436 866 8 15
ENSDART00000122516 Essential Splice Site 429 859 8 15
ENSDART00000146913 None None 306 None 6
Genomic Location:
Chromosome 10 (position 7793765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGAGGGTCTCCCAAAACTATTTTGTTCATTCCAAGATCAAATGACGG[T/A]ACGTTTACAGGATGTTTAGAATTTCAACGTTTTAAGTTCAGCATTTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046045 Nonsense 513 866 10 15
ENSDART00000122516 Nonsense 506 859 10 15
ENSDART00000146913 Nonsense 8 306 1 6
Genomic Location:
Chromosome 10 (position 7791247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCCAAGGTAATTTAGCCAAATACAAGCAGTACAACRTATCAGTCTA[T/A]CCAATCTACAAGTTCTATTATGATGGTCRATGGCATTTCCAAGCAGGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ki84zuih