LOC565514

Ensembl ID:
ENSDARG00000030472
Human Orthologue:
SLC16A5
Human Description:
solute carrier family 16, member 5 (monocarboxylic acid transporter 6) [Source:HGNC Symbol;Acc:10926
Mouse Orthologue:
Slc16a5
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 5 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38896 Nonsense Mutation detected in F1 DNA During 2017
sa27955 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045186 Nonsense 393 506 3 4
Genomic Location (Zv9):
Chromosome 12 (position 28143119)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26480728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTACGGACTGTCCATGAGTGTGGTTGGCTCGCTGATGTTCACCGTTT[T/A]GATGGACACAGTGGAAATGAGTCGATTTCCTTCTGCTCTCGGCCTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045186 Nonsense 457 506 4 4
Genomic Location (Zv9):
Chromosome 12 (position 28137766)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26475375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCATCATAGTGGTCTTATCAGCTCTGTTCCTCATGTTCACCTTTTA[C/G]TGGCTGGACTCCCGTGATGCAGCTAAAAAGGATTCTCCAGCCAAACCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link