ppa1

Ensembl ID:
ENSDARG00000030441
ZFIN ID:
ZDB-GENE-050417-375
Description:
inorganic pyrophosphatase [Source:RefSeq peptide;Acc:NP_001017833]
Human Orthologue:
PPA1
Human Description:
pyrophosphatase (inorganic) 1 [Source:HGNC Symbol;Acc:9226]
Mouse Orthologue:
Ppa1
Mouse Description:
pyrophosphatase (inorganic) 1 Gene [Source:MGI Symbol;Acc:MGI:97831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31937 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040409 Nonsense 27 291 2 11

The following transcripts of ENSDARG00000030441 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30383414)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30029362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATTCAAACCCTTTTCTGGTTTTGACAGAGAACTCAGATGGAAAATA[T/A]CTTTCACCATTCCATGACATCCCTATGTTTGCAGATGAAGCTCAGGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link