PKD1

Ensembl ID:
ENSDARG00000030417
Description:
polycystic kidney disease 1 (autosomal dominant) [Source:HGNC Symbol;Acc:9008]
Human Orthologue:
PKD1
Human Description:
polycystic kidney disease 1 (autosomal dominant) [Source:HGNC Symbol;Acc:9008]
Mouse Orthologue:
Pkd1
Mouse Description:
polycystic kidney disease 1 homolog Gene [Source:MGI Symbol;Acc:MGI:97603]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32782 Essential Splice Site Available for shipment Available now
sa19615 Essential Splice Site Available for shipment Available now
sa32781 Nonsense Mutation detected in F1 DNA During 2017
sa31236 Nonsense Available for shipment Available now
sa14458 Nonsense Available for shipment Available now
sa19614 Nonsense Available for shipment Available now
sa16772 Nonsense Available for shipment Available now
sa39705 Nonsense Mutation detected in F1 DNA During 2017
sa19613 Essential Splice Site Available for shipment Available now
sa9766 Nonsense Available for shipment Available now
sa10689 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Essential Splice Site 434 4281 13 58
Genomic Location (Zv9):
Chromosome 1 (position 54923564)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53696093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGATGTGCTGCCGGTGAGGAGGGCTCCAGGGATCGGGGTCTCTTCA[G/A]CCGGGGAACGTGTGTGTGTCTCTGGACGGCGGCGCGCAACCCAGCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Essential Splice Site 631 4281 16 58
Genomic Location (Zv9):
Chromosome 1 (position 54918579)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53691108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGAGGTGCTGATCTCACTGCCAGCCGGACCAGCAGCCAGCGTCCTGG[T/C]GAGTCAGAAACACAACTAAACTAAACTAAACTAAACTAAACTCTAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 729 4281 18 58
Genomic Location (Zv9):
Chromosome 1 (position 54914671)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53687200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCACAATATATTGAATTATTGATATATATATATGTCTTCCCACAGGTT[G/T]GAGATTACAGTTTAGAAGTGACGTCCAACGATGAGGATTTTCCCGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 1234 4281 22 58
Genomic Location (Zv9):
Chromosome 1 (position 54905034)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53677563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGTTGAGGTGTTTGTTCTACAAGTGTTATCGCTAGAACCTACCGGGTG[C/A]ATTGAAGAAAACAAAATAGTCAGCTTTCATGTGTTTGTGTCTGGGAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 1279 4281 22 58
Genomic Location (Zv9):
Chromosome 1 (position 54904899)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53677428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGRAGCCCCAATGAGACTCAGKATGGGACGCCGCTKATWACCCACTCGTA[T/A]GTYAATAGTGGTGATTACAATCTGTCACTTCTTGTGTCAAGTGACGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 1393 4281 22 58
Genomic Location (Zv9):
Chromosome 1 (position 54904559)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53677088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTACAGAACAACATCTCCTCTATCAATGCCTCAGTTTCCATTGAGATA[C/T]AGCAATCAGTTGGACTTTTGTTAATCAGCCATAATGGAGACAAAGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 1988 4281 22 58
Genomic Location (Zv9):
Chromosome 1 (position 54902774)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53675303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGAGAGCGTTCAATTCTCTGAATGGTCTWAATGTAACTAAGGTTATA[C/T]RAGTTCAGAGCATTATCAGRTCAGCATTGTTGGATGCTCAACCTAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 2908 4281 32 58
Genomic Location (Zv9):
Chromosome 1 (position 54881471)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53653897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGATACTCCAGACTCGTGGATCACAGCCTATCTGGACACCTCTGAATG[G/A]CCCAATGAATTCAACAGCACTGACAGGAAACGCATCACGCTCAACATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Essential Splice Site 3029 4281 33 58
Genomic Location (Zv9):
Chromosome 1 (position 54879725)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53652151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCCAGCCTGTTCGTCCCGCCAGACGCCGTCTCCTTCATCATTCCTG[T/C]GAGCATATACTGCTGCAACATTTTCAACAATTTACAGCATTAAATGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 3748 4281 50 58
Genomic Location (Zv9):
Chromosome 1 (position 54843847)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53615314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACACTCTNNGACCCTCGCTGTCCTCCAGAATGCCCCGTCAGTGGATA[T/A]TTCCCAGYATCCTCTYGGTTTGGGTGTGTCCAGGCCGGGTGGGCSGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039911 Nonsense 4160 4281 56 58
Genomic Location (Zv9):
Chromosome 1 (position 54830697)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 53602877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCTCCTCCGACTCCCGACAGTGYTGACGGAGGCTCTGAGGCCTCCTG[G/A]CGGCCTACATCCAGCAGCCCCTGCAGTCTGGCTGAAGTTCCTGGTCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link