twist1a

Ensembl ID:
ENSDARG00000030402
ZFIN ID:
ZDB-GENE-000210-6
Description:
twist1a [Source:RefSeq peptide;Acc:NP_571059]
Human Orthologue:
TWIST1
Human Description:
twist homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:12428]
Mouse Orthologue:
Twist1
Mouse Description:
twist homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98872]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25079 Nonsense Mutation detected in F1 DNA During 2014
sa10536 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043595 Nonsense 70 171 1 2
Genomic Location:
Chromosome 19 (position 2458688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGCCCGGGAAGAGGAGCAAGAAGTGCAGCAACAGCAGCAGCAGCCCG[C/T]AGTCTCTGGAGGACCTGCAGACGCAGCGCGTCATGGCGAACGTGCGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043595 Essential Splice Site None 171 1 2
Genomic Location:
Chromosome 19 (position 2458348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTCAACATCCCACTAACGCACGGATGCACGCGTTTRATGCAGCATGG[T/C]ATGCGATGCAAAACTTTTTRANGGCTCAAAAACTTGCACTTGAATATCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/asxto8tx