LOC100000903

Ensembl ID:
ENSDARG00000030394
Human Orthologue:
PRF1
Human Description:
perforin 1 (pore forming protein) [Source:HGNC Symbol;Acc:9360]
Mouse Orthologue:
Prf1
Mouse Description:
perforin 1 (pore forming protein) Gene [Source:MGI Symbol;Acc:MGI:97551]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10374 Nonsense Available for shipment Available now
sa8125 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028529 Nonsense 45 580 1 4
Genomic Location:
Chromosome 3 (position 31132323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCTTTGCACCCGGATCTAACCTGGCCGGAGAAGGATACGACGTGATC[A/T]AGATGCAGCGCAAGGGAGCTTTTGTCATCAACACAGACGTCTGGAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028529 Essential Splice Site 217 580 2 4
Genomic Location:
Chromosome 3 (position 31134542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTTTCTACAAGTTCATTAACACCTTTGGAACCCATTACATCACAAAG[G/A]TAATTCAAGGGTCGANNCTTCTTTATAATTTACRACACTTGCACTGAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028529 Nonsense 550 580 4 4
Genomic Location:
Chromosome 3 (position 31139145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCCCATGAACTTTCACCTGGAGAAGGTTTACGTGTCTCGAAATGCA[C/T]GACCTGTGCCACCAGAAATACTTTTAAGCCATGGAGTGCTTCTGGACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yo51bw1k