grin2bb

Ensembl ID:
ENSDARG00000030376
ZFIN ID:
ZDB-GENE-061207-27
Description:
glutamate [Source:RefSeq peptide;Acc:NP_001121809]
Human Orthologue:
GRIN2B
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Mouse Orthologue:
Grin2b
Mouse Description:
glutamate receptor, ionotropic, NMDA2B (epsilon 2) Gene [Source:MGI Symbol;Acc:MGI:95821]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12697 Nonsense Available for shipment Available now
sa7913 Nonsense Mutation detected in F1 DNA During 2014
sa19556 Nonsense Mutation detected in F1 DNA During 2014
sa9856 Nonsense Available for shipment Available now
sa18703 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 555 1770 9 16
ENSDART00000143664 Nonsense 555 1770 8 15
Genomic Location:
Chromosome 1 (position 45877619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTATAGACATCCTCAAGAAKATCGCCAAGTCTGTCAAATTCACCTA[C/A]GATCTCTACTTGGTGACCAATGGGAARCACGGCAAGAAGATCAACGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1082 1770 16 16
ENSDART00000143664 Nonsense 1082 1770 15 15
Genomic Location:
Chromosome 1 (position 45849231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCATTACCTACACCACCATGGGGGATCTGAACTGGCTCTYGGTATGT[C/A]GGGTCCCCTGCCTAAYCGACCTCGTAGCTTAGGGAGTGCCAGCTCATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1097 1770 16 16
ENSDART00000143664 Nonsense 1097 1770 15 15
Genomic Location:
Chromosome 1 (position 45849186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTCGGGTCCCCTGCCTAACCGACCTCGTAGCTTAGGGAGTGCCAGCT[C/A]ATTGGAGGGTGGGTACGATTGTGACAGTTTAGGGGGAGGGGTAGCGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
Genomic Location:
Chromosome 1 (position 45848953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGRGGCATCCAGTTCAGGGTTTATTGCAGGACATGACAGGTACTGCGGG[G/T]GAGGTGGGGTGGGATCGGGAGGGGACGATGGAAACATTCGATCSGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
ENSDART00000092613 Nonsense 1175 1770 16 16
ENSDART00000143664 Nonsense 1175 1770 15 15
Genomic Location:
Chromosome 1 (position 45848953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGGCATCCAGTTCAGGGTTTATTGCAGGACATGACAGGTACTGCGGG[G/T]GAGGTGGGGTGGGATCGGGAGGGGACGATGGAAACATTCGATCCGACGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ab8ihgyf