naa15b

Ensembl ID:
ENSDARG00000030368
ZFIN ID:
ZDB-GENE-030131-6031
Description:
N(alpha)-acetyltransferase 15, NatA auxiliary subunit b [Source:RefSeq peptide;Acc:NP_976066]
Human Orthologue:
NAA15
Human Description:
N(alpha)-acetyltransferase 15, NatA auxiliary subunit [Source:HGNC Symbol;Acc:30782]
Mouse Orthologue:
Naa15
Mouse Description:
N(alpha)-acetyltransferase 15, NatA auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:1922088]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17329 Essential Splice Site Available for shipment Available now
sa30585 Nonsense Mutation detected in F1 DNA During 2017
sa19540 Nonsense Available for shipment Available now
sa14582 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040798 Essential Splice Site 46 800 2 19
ENSDART00000123873 Essential Splice Site 46 685 2 16
ENSDART00000130490   None 559 None 14
ENSDART00000133343 Essential Splice Site 29 208 3 7
Genomic Location (Zv9):
Chromosome 1 (position 41011405)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39900814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATTCTGCAAACAGATCCTCTCYAAYTCAAAGTTCTCAGAACATGGAG[G/A]TAAGAACCACAGGTGGAAGTGTTTGTGACGGCTACAACCAGACATCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040798 Nonsense 71 800 3 19
ENSDART00000123873 Nonsense 71 685 3 16
ENSDART00000130490   None 559 None 14
ENSDART00000133343 Nonsense 54 208 4 7
Genomic Location (Zv9):
Chromosome 1 (position 41012377)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39901786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGCTAAACTGCCTGGGGAAGAAAGAAGAAGCCTATGAACTAGTCCGC[C/T]GAGGGCTCCGAAATGACCTGAAGAGCCACGTCTGTATCCTTGGAGCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040798 Nonsense 247 800 7 19
ENSDART00000123873 Nonsense 247 685 7 16
ENSDART00000130490 Nonsense 121 559 5 14
ENSDART00000133343   None 208 None 7
Genomic Location (Zv9):
Chromosome 1 (position 41019743)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39909152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGCTTCTGTTGAATCTGGAGCGGTTTGAGGAGGCGGCAGATGTGTA[C/A]AGAAGACTGCAGGAGAGGAATCCGGAGAACTGGTTGTATTACCATGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040798 Nonsense 451 800 12 19
ENSDART00000123873 Nonsense 451 685 12 16
ENSDART00000130490 Nonsense 325 559 10 14
ENSDART00000133343   None 208 None 7
Genomic Location (Zv9):
Chromosome 1 (position 41024707)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39914116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCTTTGGACACCGCCGACCGCTTTATTAACTCCAAATGCGCCAAGTA[T/A]CTTCTTAAAGCTGGCCTGGTCARAGAGGCTGAGGAAATGTGCGCCAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link