metrn

Ensembl ID:
ENSDARG00000030367
ZFIN ID:
ZDB-GENE-050102-1
Description:
meteorin [Source:RefSeq peptide;Acc:NP_001009983]
Human Orthologue:
METRN
Human Description:
meteorin, glial cell differentiation regulator [Source:HGNC Symbol;Acc:14151]
Mouse Orthologue:
Metrn
Mouse Description:
meteorin, glial cell differentiation regulator Gene [Source:MGI Symbol;Acc:MGI:1917333]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44184 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041805 Nonsense 142 283 2 4
Genomic Location (Zv9):
Chromosome 24 (position 39455626)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38064715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGCACCGGGATATCAGCAGACGCATCGCTGCCTTCCGCTACGAGCTG[A/T]GAGGGGATTGGACGGCGCAGCCAGCAGTCAACACAGATCCAGTCAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link