angpt1

Ensembl ID:
ENSDARG00000030364
ZFIN ID:
ZDB-GENE-010817-1
Description:
angiopoietin-1 [Source:RefSeq peptide;Acc:NP_571888]
Human Orthologue:
ANGPT1
Human Description:
angiopoietin 1 [Source:HGNC Symbol;Acc:484]
Mouse Orthologue:
Angpt1
Mouse Description:
angiopoietin 1 Gene [Source:MGI Symbol;Acc:MGI:108448]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30714 Nonsense Mutation detected in F1 DNA During 2016
sa14264 Nonsense Available for shipment Available now
sa43349 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043713 Nonsense 2 513 1 9
Genomic Location:
Chromosome 19 (position 48862631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTGATATATTTGTGAGTTTTCCGTCCCATCGGGCTCCTGCCATGTG[G/A]TGGGGTTGCTTGTTTCTGGCAGCGCTGCTGGTGGTTGCAGATTGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043713 Nonsense 261 513 4 9
Genomic Location:
Chromosome 19 (position 48775705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAATCAGCTGAGCAGAGCTACCGGAAACAGCACAGCACTTCAGAGA[C/T]AGCAGCAGGACCTGAYGGAGAGCATGCGCAGCCTCCTCAGCCTCTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043713 Essential Splice Site 326 513 5 9
Genomic Location:
Chromosome 19 (position 48762659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAACGGAGTTTACACCATCAATATTAGCCCACAAGAGACCAAAAAGG[T/C]AAATTATTCAATAAATCTTTGTTGAAACAAAGGTAAAGGGGAGACTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link