angpt1

Ensembl ID:
ENSDARG00000030364
ZFIN ID:
ZDB-GENE-010817-1
Description:
angiopoietin-1 [Source:RefSeq peptide;Acc:NP_571888]
Human Orthologue:
ANGPT1
Human Description:
angiopoietin 1 [Source:HGNC Symbol;Acc:484]
Mouse Orthologue:
Angpt1
Mouse Description:
angiopoietin 1 Gene [Source:MGI Symbol;Acc:MGI:108448]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043713 Nonsense 261 513 4 9
Genomic Location:
Chromosome 19 (position 48775705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAATCAGCTGAGCAGAGCTACCGGAAACAGCACAGCACTTCAGAGA[C/T]AGCAGCAGGACCTGAYGGAGAGCATGCGCAGCCTCCTCAGCCTCTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7v3n9see