cryba2a

Ensembl ID:
ENSDARG00000030349
ZFIN ID:
ZDB-GENE-040625-8
Description:
crystallin, beta A2a [Source:RefSeq peptide;Acc:NP_001002049]
Human Orthologue:
CRYBA2
Human Description:
crystallin, beta A2 [Source:HGNC Symbol;Acc:2395]
Mouse Orthologue:
Cryba2
Mouse Description:
crystallin, beta A2 Gene [Source:MGI Symbol;Acc:MGI:104336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2321 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2321
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041269 Nonsense 150 197 5 5
Genomic Location:
Chromosome 6 (position 13691345)
KASP Assay ID:
554-3311.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAATAATACTGTTTTTTCCCNTTCCTCAACCTCGCACATGCGRCAGCTG[G/A]GTGGGTTACCAGTTTCCAGGTTACCGTGGATACCAGTATATCTTTGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vnn0vo3v