hspa12b

Ensembl ID:
ENSDARG00000030307
ZFIN ID:
ZDB-GENE-070226-1
Description:
heat shock 70 kDa protein 12B [Source:RefSeq peptide;Acc:NP_001036151]
Human Orthologue:
HSPA12B
Human Description:
heat shock 70kD protein 12B [Source:HGNC Symbol;Acc:16193]
Mouse Orthologue:
Hspa12b
Mouse Description:
heat shock protein 12B Gene [Source:MGI Symbol;Acc:MGI:1919880]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41057 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087093 Essential Splice Site 151 691 5 13
ENSDART00000129278 Essential Splice Site 151 691 4 12

The following transcripts of ENSDARG00000030307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 60605228)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59824193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATTGGCTATACTTTGACAAATTCAAAATGAAAATCCACAGCACAAGT[G/A]TAAGCTAAACATATATTACATATTGACTGTTTTTTTTCTCTCTCTTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link