galntl4a

Ensembl ID:
ENSDARG00000030292
ZFIN IDs:
ZDB-GENE-080723-30, ZDB-GENE-080723-30, ZDB-GENE-080723-30
Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4a [Source:Re
Human Orthologue:
GALNTL4
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 [Source:HGNC
Mouse Orthologue:
Galntl4
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4 Gene [Source

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32525 Nonsense Available for shipment Available now
sa24644 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082605 Nonsense 381 609 7 11
ENSDART00000126443 Nonsense 469 697 7 11
ENSDART00000129499 Nonsense 381 609 7 11
Genomic Location (Zv9):
Chromosome 25 (position 18270152)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17686462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCAGGTTTGGTTGTGTGGAGGAAGTGTGGAGGTCATACCCTGCTCC[A/T]GAATAGCTCATATTGAACGCGCACACAAGCCCTACACAGAGGATCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082605 Nonsense 571 609 11 11
ENSDART00000126443 Nonsense 659 697 11 11
ENSDART00000129499 Nonsense 571 609 11 11
Genomic Location (Zv9):
Chromosome 25 (position 18312178)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17728488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTATCTGTCTTGTGTTTGCAGGGAGGCTCCATTCAGAACAAAAAGTCG[A/T]AACGTTGTTTGGAGTTGGTAGAAAGTGCAGATGTGGATCATGGATATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link